Gene name |
SPCC1442.04c |
Gene ID |
19/F02 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; hypothetical protein |
Entry clone |
Cloned#/Sequence
mismatch |
ORF length (unspliced) |
1230 |
ORF length (spliced) |
|
Entry clone length |
1230 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
(1191~1194)GATC:addition |
Comments |
GATC insertion at
position 1191 as compared with the data from the genome
project. |
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1442.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCGGAGTGAGTCCTGT |
Rev primer name |
SPCC1442.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACGTTCTCATCTTCAACATC |
Amino acid length |
409 |
Molecular weight |
45.8 |
Isoelectric point (calc.) |
3.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Confocal
|