| Gene name |
SPCC1442.04c |
| Gene ID |
19/F02 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; hypothetical protein |
| Entry clone |
Cloned#/Sequence
mismatch |
| ORF length (unspliced) |
1230 |
| ORF length (spliced) |
|
| Entry clone length |
1230 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
(1191~1194)GATC:addition |
| Comments |
GATC insertion at
position 1191 as compared with the data from the genome
project. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1442.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCGGAGTGAGTCCTGT |
| Rev primer name |
SPCC1442.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGTTCTCATCTTCAACATC |
| Amino acid length |
409 |
| Molecular weight |
45.8 |
| Isoelectric point (calc.) |
3.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|