Gene name |
SPCC4G3.16 |
Gene ID |
19/D06 |
Gene synonyms/obsolete |
|
Gene product |
drap deaminase;
involved in riboflavin biosynthesis; RLU family pseudouridine
synthase |
Entry clone |
Cloned |
ORF length (unspliced) |
1218 |
ORF length (spliced) |
|
Entry clone length |
1218 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
59T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC4G3.16.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAATTCCAGAAAAATA |
Rev primer name |
SPCC4G3.16.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTGCTTTGGGGGGTGACCA |
Amino acid length |
405 |
Molecular weight |
45.6 |
Isoelectric point (calc.) |
5.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |