| Gene name |
SPBC14F5.08 |
| Gene ID |
19/B06 |
| Gene synonyms/obsolete |
med7 |
| Gene product |
RNA polymerase II
holoenzyme component; mediator complex subunit; essential;
involved in regulating RNA polymerase II activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1197 |
| ORF length (spliced) |
1131 |
| Entry clone length |
1197 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
488A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC14F5.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACCAAACGAAGGAGT |
| Rev primer name |
SPBC14F5.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCTAAGATCTCGTTTTATC |
| Amino acid length |
376 |
| Molecular weight |
43.5 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRFLSRSLML |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|