Gene name |
SPBC3D6.02 |
Gene ID |
18/E12 |
Gene synonyms/obsolete |
|
Gene product |
Sp specific families;
glycoprotein; similar to Sp SPAC27D7.09c and SPAC27D7.10c and
SPAC27D7.11c (paralogs) |
Entry clone |
Cloned |
ORF length (unspliced) |
1173 |
ORF length (spliced) |
|
Entry clone length |
1173 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
6A:T / 340A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3D6.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAATTGTTAAACTCTTT |
Rev primer name |
SPBC3D6.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCGAAGTTAGCATTGGAG |
Amino acid length |
390 |
Molecular weight |
43.6 |
Isoelectric point (calc.) |
9.2 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Confocal
|