Gene name |
SPBC3B9.02c |
Gene ID |
18/B03 |
Gene synonyms/obsolete |
cwf28;
SPBC3B9.02a |
Gene product |
G-patch domain;
complexed with Cdc5p |
Entry clone |
Cloned |
ORF length (unspliced) |
1146 |
ORF length (spliced) |
|
Entry clone length |
1146 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
301T:C / 940A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3B9.02a.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGCGAAAAGCCGTATT |
Rev primer name |
SPBC3B9.02a.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGTGTACGAGTACTTCTG |
Amino acid length |
381 |
Molecular weight |
44.2 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
67/355 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB?; nucleus; spindle
microtubules |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |