| Gene name |
SPBP4H10.05c |
| Gene ID |
17/H11 |
| Gene synonyms/obsolete |
spe2 |
| Gene product |
S-adenosylmethionine
decarboxylase proenzyme; involved in spermidine and spermine
biosynthesis; required for growth in the absence of
spermidine |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1137 |
| ORF length (spliced) |
|
| Entry clone length |
1137 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
462A:G / 719T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP4H10.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCCTACCCTTGTTGT |
| Rev primer name |
SPBP4H10.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATACTGCAGTAAAGCTGGCA |
| Amino acid length |
378 |
| Molecular weight |
42.7 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLASLPRLLEI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |