| Gene name |
SPBC1289.13c |
| Gene ID |
17/G01 |
| Gene synonyms/obsolete |
|
| Gene product |
alpha-1,2-galactosyltransferase; GMA12/MNN10 family;
predicted N-terminal signal sequence; similar to S. pombe gmh1
and gmh3 and gmh2 and gma12 and SPAC5H10.13C and SPAC637.06
and SPBC8D2.17 paralogs; similar to S. cerevisiae
YDR245W and YJL183W |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1128 |
| ORF length (spliced) |
|
| Entry clone length |
1128 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1289.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTTGGTATTCTTATGT |
| Rev primer name |
SPBC1289.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGTTGAGGGAAAAGGCGT |
| Amino acid length |
375 |
| Molecular weight |
43.1 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER; Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |