Gene name |
SPCC1183.06 |
Gene ID |
17/B07 |
Gene synonyms/obsolete |
ung1 |
Gene product |
uracil DNA
N-glycosylase; uracil DNA N-glycosylase activity;
overexpression induces checkpoint-dependent cell cycle delay
|
Entry clone |
Cloned |
ORF length (unspliced) |
1093 |
ORF length (spliced) |
969 |
Entry clone length |
1093 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
464T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1183.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGTTCTGAATACTAC |
Rev primer name |
SPCC1183.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCAGTTGAAGAGGATTCC |
Amino acid length |
322 |
Molecular weight |
36.7 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Confocal
|