Gene name |
SPAC4F10.03c |
Gene ID |
16/F04 |
Gene synonyms/obsolete |
|
Gene product |
tRNA
methyltransferase; 2'-O-ribose tRNA anticodon loop
methyltransferase |
Entry clone |
Cloned |
ORF length (unspliced) |
1076 |
ORF length (spliced) |
858 |
Entry clone length |
1076 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
132T:C / 334T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC4F10.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGAGAAGCAGCAAAGA |
Rev primer name |
SPAC4F10.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACGACATCATCTTGCTATGC |
Amino acid length |
285 |
Molecular weight |
31.4 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |