| Gene name |
SPAC11H11.04 |
| Gene ID |
15/H10 |
| Gene synonyms/obsolete |
mam2 |
| Gene product |
pheromone P-factor
receptor; fungal pheromone mating factor STE2 GPCR |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1047 |
| ORF length (spliced) |
|
| Entry clone length |
1047 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC11H11.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGACAACCATGGTGGAA |
| Rev primer name |
SPAC11H11.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGTCCACTTTTTAGTTTCA |
| Amino acid length |
348 |
| Molecular weight |
39.2 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery at cell tip
and site of septum formation; vacuole |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |