Gene name |
SPAC5H10.13c |
Gene ID |
15/G07 |
Gene synonyms/obsolete |
gmh2 |
Gene product |
alpha-1,2-galactosyltransferase Gmh2; GMA12/MNN10
family; belongs to the glycosyltransferase 34 family;
predicted N-terminal signal sequence; similar to S. pombe gmh3
and gmh1 and gma12 and SPBC1289.13C and SPAC5H10.13C and
SPAC637.06 and SPBC8D2.17 |
Entry clone |
Cloned |
ORF length (unspliced) |
1041 |
ORF length (spliced) |
|
Entry clone length |
1041 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
56T:C / 336T:C /
361G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC5H10.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCACTTATGTTATCCAG |
Rev primer name |
SPAC5H10.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTCAATCAAGGCGTAAAAC |
Amino acid length |
346 |
Molecular weight |
39.1 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |