Gene name |
SPCC61.04c |
Gene ID |
15/F10 |
Gene synonyms/obsolete |
|
Gene product |
Rab GTPase binding;
Yip1 family; 5 predicted transmembrane helices; involved in
intracellular protein transport; involved in ER to Golgi
transport; interacts physically with SPBC25H2.06c; complexed
with SPBC25H2.06c |
Entry clone |
Cloned |
ORF length (unspliced) |
1035 |
ORF length (spliced) |
684 |
Entry clone length |
1035 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
247T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC61.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTACTACAACAACCC |
Rev primer name |
SPCC61.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTCGAAAACACGGTGATC |
Amino acid length |
227 |
Molecular weight |
25.3 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |