Gene name |
SPCC777.05 |
Gene ID |
15/E02 |
Gene synonyms/obsolete |
gtr2 |
Gene product |
small GTPase;
interacts physically with Gtr1p (C-terminal) (2-hybrid) |
Entry clone |
Cloned |
ORF length (unspliced) |
1026 |
ORF length (spliced) |
945 |
Entry clone length |
1026 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
128A:G / 275A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC777.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGCCTAGAAAGATTAT |
Rev primer name |
SPCC777.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGTTCTAGGTGAGAAAATG |
Amino acid length |
314 |
Molecular weight |
35.5 |
Isoelectric point (calc.) |
4.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPTLENLLNI/LREMNQYLAL |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |