| Gene name |
SPCC1739.10 |
| Gene ID |
15/A08 |
| Gene synonyms/obsolete |
|
| Gene product |
membrane anchored
protein; involved in intracellular signalling cascade; similar
to Sp SPAC13G7.04c (paralog); possibly fungal specific |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1011 |
| ORF length (spliced) |
|
| Entry clone length |
1011 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1739.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGGATTCGTAGTGCTAC |
| Rev primer name |
SPCC1739.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGAGCGGCCCCATGAAAAT |
| Amino acid length |
336 |
| Molecular weight |
37 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
4 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery at cell tip
and site of septum formation; cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |