Gene name |
SPCC1494.01 |
Gene ID |
14/H03 |
Gene synonyms/obsolete |
SPCC965.15 |
Gene product |
Iron/ascorbate
oxidoreductase family; no apparent Sc ortholog; 2 OG-Fe(II)
oxygenase superfamily; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1007 |
ORF length (spliced) |
966 |
Entry clone length |
1007 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
446C:T / 618T:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1494.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGATCCTTAGAAGTACC |
Rev primer name |
SPCC1494.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCCACAATACCATCATTT |
Amino acid length |
321 |
Molecular weight |
36.4 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |