| Gene name |
SPAC27E2.02 |
| Gene ID |
14/F12 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved protein;
UPF0029; involved in general amino acid control response;
similar to M. musculus IMPACT protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1002 |
| ORF length (spliced) |
843 |
| Entry clone length |
1002 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC27E2.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAATAATGAAGAATT |
| Rev primer name |
SPAC27E2.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTTCTTCTTTTTGCCA |
| Amino acid length |
280 |
| Molecular weight |
31.4 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |