| Gene name |
SPAC1002.07c |
| Gene ID |
14/F09 |
| Gene synonyms/obsolete |
ats1 |
| Gene product |
N-acetyltransferase;
GNAT family; closest Sc homologs HPA2 and HPA3 are histone
acetyltransferases but Sp sequence is more similar to
bacterial acetyltransferases?; human homolog SAT is a
Spermidine/spermine N1-acetyltransferase which catalyzes
rate-limiting step in polyamine catabolism |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1000 |
| ORF length (spliced) |
507 |
| Entry clone length |
1000 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
425A:G / 834T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1002.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTTCAGTTCGCATTCG |
| Rev primer name |
SPAC1002.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAGTTGCCGGGAAGTTTA |
| Amino acid length |
168 |
| Molecular weight |
19.1 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |