| Gene name |
SPAC222.06 |
| Gene ID |
13/F05 |
| Gene synonyms/obsolete |
|
| Gene product |
nuclear HMG-like
acidic protein; involved in ribosome biogenesis and assembly
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
962 |
| ORF length (spliced) |
909 |
| Entry clone length |
962 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
597A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC222.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGCAAGACGAGGTGAT |
| Rev primer name |
SPAC222.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCAAGAATGTTGAACAGCA |
| Amino acid length |
302 |
| Molecular weight |
35.6 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
263 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |