Gene name |
SPAC2F3.01 |
Gene ID |
13/F01 |
Gene synonyms/obsolete |
SPAC323.09 |
Gene product |
involved in the
synthesis of mannosylated sphingolipids |
Entry clone |
Cloned |
ORF length (unspliced) |
960 |
ORF length (spliced) |
|
Entry clone length |
960 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC2F3.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAGGAAATGTCGCAA |
Rev primer name |
SPAC2F3.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGGATATAGCTCCTGTATT |
Amino acid length |
319 |
Molecular weight |
37.1 |
Isoelectric point (calc.) |
9.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
2 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
Golgi |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |