| Gene name |
SPAC823.05c |
| Gene ID |
13/E10 |
| Gene synonyms/obsolete |
tlg2 |
| Gene product |
SNARE; 1 predicted
transmembrane helix; t-SNARE that functions in transport from
the endosome to the late Golgi and on the endocytic pathway
(By similarity); syntaxin/epimorphin family; 1 t-SNARE
coiled-coil homology domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
958 |
| ORF length (spliced) |
906 |
| Entry clone length |
958 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC823.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCTATCGAGACCGTAC |
| Rev primer name |
SPAC823.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCGAAGCAGTTTAATTGCC |
| Amino acid length |
301 |
| Molecular weight |
34.4 |
| Isoelectric point (calc.) |
7.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRFICFLIL/LIVALIVILAI |
| Localization (YFP) |
Golgi; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |