| Gene name |
SPBC1539.08 |
| Gene ID |
13/E01 |
| Gene synonyms/obsolete |
|
| Gene product |
ADP-ribosylation
factor predicted; ARF family; function GTP-binding protein
that functions as an allosteric activator of the cholera toxin
catalytic subunit, an ADP- ribosyltransferase; involved in
protein trafficking; may modulate vesicle budding and
uncoating within the Golgi apparatus (By similarity).; similar
to S. pombe SPBC4F6.18c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
954 |
| ORF length (spliced) |
555 |
| Entry clone length |
954 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
658G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1539.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCAATTCACTATTTAA |
| Rev primer name |
SPBC1539.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTAACTTTGCGTTTTGA |
| Amino acid length |
184 |
| Molecular weight |
20.7 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |