| Gene name |
SPAC521.01c |
| Gene ID |
12/G08 |
| Gene synonyms/obsolete |
SPAC2G11.15c |
| Gene product |
RNA methyltransferase
activity; involved in snRNA capping |
| Entry clone |
Cloned |
| ORF length (unspliced) |
919 |
| ORF length (spliced) |
720 |
| Entry clone length |
919 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC521.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACAAGAACGAAGAACT |
| Rev primer name |
SPAC521.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATTTTTCGCGCAATAGCA |
| Amino acid length |
239 |
| Molecular weight |
27.1 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; spindle
microtubules; cytoplasmic microtubules;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus) |
| Microscope used for
observation |
DeltaVision |