| Gene name |
SPAC23C4.15 |
| Gene ID |
12/E06 |
| Gene synonyms/obsolete |
rpb5 |
| Gene product |
experimentally
characterised; DNA-directed RNA polymerase (I, II, and III
subunit); involved in transcription from Pol I promoter, Pol
II promoter and Pol III promoter; DNA-directed RNA polymerase
activity (function of complex); interacts physically with
Rpb1p; interacts physically with Rpb2p; interacts physically
with Rpb3p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
908 |
| ORF length (spliced) |
633 |
| Entry clone length |
908 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
757A:G / 766A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23C4.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGCGGAAGAAAAAAA |
| Rev primer name |
SPAC23C4.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCACAAATTCTGTAGCTA |
| Amino acid length |
210 |
| Molecular weight |
23.9 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LADPVARYLGL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |