| Gene name |
SPAC25G10.01 |
| Gene ID |
12/B10 |
| Gene synonyms/obsolete |
SPAC2C4.18 |
| Gene product |
RNA-binding protein;
putative ribonucleoprotein; rrm RNA recognition motif; no
apparent orthologs (conserved rrm only) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
894 |
| ORF length (spliced) |
|
| Entry clone length |
894 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
524A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC25G10.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATACTCTACCTCCCGC |
| Rev primer name |
SPAC25G10.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGATCTTCGTTTGGAGGC |
| Amino acid length |
297 |
| Molecular weight |
33.5 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
251 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |