| Gene name |
SPAC1565.06c |
| Gene ID |
11/H01 |
| Gene synonyms/obsolete |
spg1; sid3 |
| Gene product |
GTPase Spg1; Ras
family; essential; activated by Byr4p and Cdc16p two-component
GAP; similar to S. cerevisiae YML064C; SIN component;
involved in regulation of septation; involved in septation
(required); involved in cytokinesis (required); involved in
mitotic exit; deletion mutant results in absence of division
septum resulting in elongated multinucleate cells;
overexpression induces septum formation; interacts physically
with Cdc7p (2-hybrid) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
875 |
| ORF length (spliced) |
597 |
| Entry clone length |
875 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1565.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGATGCTAGAAAAAA |
| Rev primer name |
SPAC1565.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCGATCGATGTATTCCAAA |
| Amino acid length |
198 |
| Molecular weight |
22.5 |
| Isoelectric point (calc.) |
9.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB |
| Comments for localization |
nucleus>cytosol by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |