Gene name |
SPCC4B3.14 |
Gene ID |
11/G11 |
Gene synonyms/obsolete |
cwf20 |
Gene product |
involved in mRNA
splicing; complexed with Cdc5p; no apparent orthologs |
Entry clone |
Cloned |
ORF length (unspliced) |
873 |
ORF length (spliced) |
|
Entry clone length |
873 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
162T:G / 399A:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC4B3.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCTGGTTTCATATCC |
Rev primer name |
SPCC4B3.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAACCCATACTTTTGAGAA |
Amino acid length |
290 |
Molecular weight |
32.5 |
Isoelectric point (calc.) |
9.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |