Gene name |
SPAC644.03c |
Gene ID |
11/G06 |
Gene synonyms/obsolete |
SPAC4F8.01 |
Gene product |
involved in
intracellular protein transport; SNF7 family; class E vps;
predicted coiled-coil |
Entry clone |
Cloned |
ORF length (unspliced) |
872 |
ORF length (spliced) |
633 |
Entry clone length |
872 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC644.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCTTAACTTCTTGGCT |
Rev primer name |
SPAC644.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGCTTTGCCAGTTCATCC |
Amino acid length |
210 |
Molecular weight |
23.9 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |