| Gene name |
SPAC644.03c |
| Gene ID |
11/G06 |
| Gene synonyms/obsolete |
SPAC4F8.01 |
| Gene product |
involved in
intracellular protein transport; SNF7 family; class E vps;
predicted coiled-coil |
| Entry clone |
Cloned |
| ORF length (unspliced) |
872 |
| ORF length (spliced) |
633 |
| Entry clone length |
872 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC644.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCTTAACTTCTTGGCT |
| Rev primer name |
SPAC644.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGCTTTGCCAGTTCATCC |
| Amino acid length |
210 |
| Molecular weight |
23.9 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |