Gene name |
SPAC1687.02 |
Gene ID |
11/F05 |
Gene synonyms/obsolete |
|
Gene product |
CAAX prenyl protease;
involved in the proteolytic maturation of farnesylated
proteins; peptidase family U48 |
Entry clone |
Cloned |
ORF length (unspliced) |
867 |
ORF length (spliced) |
816 |
Entry clone length |
867 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
474T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1687.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGAGTTTATTTAATTTC |
Rev primer name |
SPAC1687.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTTAATGGCACCAGTCTT |
Amino acid length |
271 |
Molecular weight |
31 |
Isoelectric point (calc.) |
8.7 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |