Gene name |
SPCC825.03c |
Gene ID |
11/C10 |
Gene synonyms/obsolete |
psy1 |
Gene product |
SNARE; essential;
involved in secretory pathway; transcription enhanced during
sporulation; interacts genetically with spo3 |
Entry clone |
Cloned |
ORF length (unspliced) |
855 |
ORF length (spliced) |
|
Entry clone length |
855 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
588A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC825.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATAAAGCAAACGATTA |
Rev primer name |
SPCC825.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGTCTATTGCCAAGAACA |
Amino acid length |
284 |
Molecular weight |
32.5 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
Golgi |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |