| Gene name |
SPAC5H10.08c |
| Gene ID |
11/B08 |
| Gene synonyms/obsolete |
|
| Gene product |
pantoate--beta-alanine
ligase; involved in pantothenate biosynthesis (last step);
possibly coexpressed with SPAC5H10.09c which is also involved
in pantothenate biosynthesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
852 |
| ORF length (spliced) |
|
| Entry clone length |
852 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
7G:A / 175C:T /
372A:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC5H10.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGGTTCTTAAAGAGAA |
| Rev primer name |
SPAC5H10.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTGATGGTTGTTTGGATA |
| Amino acid length |
283 |
| Molecular weight |
31.8 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus or
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |