| Gene name |
SPBC1703.11 |
| Gene ID |
11/A04 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved hypothetical
protein; similar to A. thaliana F9D24.60 and F3M18.5, H.
sapiens HRC01029, D. melanogaster CG13601; conserved
KL..L.{ILV}{KR}{TQH}{LIV}{KR}..{SC}KP{IL}{AG}{NS}.{IL}K..
AK.*F{RK}; predicted coiled-coil protein; no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
840 |
| ORF length (spliced) |
657 |
| Entry clone length |
840 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
27A:G / 135A:G /
422A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1703.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCTCTAGCCTTAAA |
| Rev primer name |
SPBC1703.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCTGTAGAAACCGATTTG |
| Amino acid length |
218 |
| Molecular weight |
24.5 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
104 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
1~2 dots/cell |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |