Gene name |
SPBC1105.09 |
Gene ID |
10/D02 |
Gene synonyms/obsolete |
ubc15 |
Gene product |
ubiquitin conjugating
enzyme; involved in the regulation of transcriptional
silencing of heterochromatin; no apparent Sc ortholog;
involved in transcriptional silencing of the mating-type
region; overexpression derepressed transcriptional silencing
of the mating-type region |
Entry clone |
Cloned |
ORF length (unspliced) |
810 |
ORF length (spliced) |
504 |
Entry clone length |
810 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
328G:A / 700A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1105.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTTCTTCTGCTAGTGA |
Rev primer name |
SPBC1105.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATCATTTCAATTGACCTG |
Amino acid length |
167 |
Molecular weight |
19.1 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Confocal
|