Gene name |
SPAC1B3.14 |
Gene ID |
10/C12 |
Gene synonyms/obsolete |
vma3 |
Gene product |
V-type ATPase;
vacuolar ATP synthase subunit; V0 sector; proteolipid
subunit |
Entry clone |
Cloned |
ORF length (unspliced) |
810 |
ORF length (spliced) |
486 |
Entry clone length |
810 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1B3.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACAGATCTTTGGTA |
Rev primer name |
SPAC1B3.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCACTAAAGAGGGTTAGCC |
Amino acid length |
161 |
Molecular weight |
16.3 |
Isoelectric point (calc.) |
8.4 |
Signal SEQ |
|
No. of transmembrane domain |
4 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LILIFAEVLGL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|