Gene name |
SPAC23H4.03c |
Gene ID |
09/G08 |
Gene synonyms/obsolete |
erv25 |
Gene product |
COPII-coated vesicle
component predicted; emp24 family; predicted N-terminal signal
sequence; 1 predicted transmembrane helix |
Entry clone |
Cloned# |
ORF length (unspliced) |
784 |
ORF length (spliced) |
651 |
Entry clone length |
784 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC23H4.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGGTTTCTTTGAAATC |
Rev primer name |
SPAC23H4.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGGATAAGATGCTTCCTT |
Amino acid length |
216 |
Molecular weight |
24.4 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKSSLFFMLAL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |