Gene name |
SPAC22F3.05c |
Gene ID |
09/F10 |
Gene synonyms/obsolete |
alp41 |
Gene product |
ADP-ribosylation
factor; GTP-binding protein; essential for co-factor dependent
biogenesis of microtubules |
Entry clone |
Cloned |
ORF length (unspliced) |
778 |
ORF length (spliced) |
561 |
Entry clone length |
778 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
14C:T / 441T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC22F3.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGATTATTGACTATTTT |
Rev primer name |
SPAC22F3.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATAATCAATAGTTCCCAAC |
Amino acid length |
186 |
Molecular weight |
21.2 |
Isoelectric point (calc.) |
5.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |