| Gene name |
SPAC9E9.13 |
| Gene ID |
09/D02 |
| Gene synonyms/obsolete |
wos2 |
| Gene product |
p23 homolog; Hsp
associated co-chaperone; interacts physically with Hsp90p;
involved in mitotic control; interacts with Wee1p; interacts
physically with Cdc2p; 3' UTR directs the formation multiple
mRNAs; alternative polyadenylation sites results in the
production of the 3 differently sized transcripts; alternative
transcripts |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
760 |
| ORF length (spliced) |
561 |
| Entry clone length |
760 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC9E9.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTTAAATACACAAAT |
| Rev primer name |
SPAC9E9.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCTTTCTTTTCGTTACTG |
| Amino acid length |
186 |
| Molecular weight |
20.9 |
| Isoelectric point (calc.) |
4.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>=cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |