Gene name |
SPAC23A1.07 |
Gene ID |
09/C06 |
Gene synonyms/obsolete |
|
Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3) |
Entry clone |
Cloned |
ORF length (unspliced) |
756 |
ORF length (spliced) |
|
Entry clone length |
756 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
210A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23A1.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATAGAGTCGGAATTAGC |
Rev primer name |
SPAC23A1.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACCCATTGTCTGATCAGGC |
Amino acid length |
251 |
Molecular weight |
28.2 |
Isoelectric point (calc.) |
8.8 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots |
Comments for localization |
bright dots by over
expression; 1~3 dots/cell |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |