| Gene name |
SPBC3E7.13c |
| Gene ID |
08/H11 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in mRNA
splicing; complexed with Cdc5p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
739 |
| ORF length (spliced) |
690 |
| Entry clone length |
739 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
184T:A / 272A:G /
456A:G / 500G:C / 656A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC3E7.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACTCGCCTTCTCACTC |
| Rev primer name |
SPBC3E7.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGAGCCGTACCTCGTTCC |
| Amino acid length |
229 |
| Molecular weight |
27.9 |
| Isoelectric point (calc.) |
9.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
179/74 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |