Gene name |
SPAC15E1.09 |
Gene ID |
08/D09 |
Gene synonyms/obsolete |
grx2 |
Gene product |
arsenate reductase
(glutaredoxin) activity; glutaredoxin; thioltransferase;
similar to Sp grx1 (paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
711 |
ORF length (spliced) |
333 |
Entry clone length |
711 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
391T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC15E1.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCTATAGCAAAAGC |
Rev primer name |
SPAC15E1.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAAAATTGAAGATTTGTTT |
Amino acid length |
110 |
Molecular weight |
12.2 |
Isoelectric point (calc.) |
10 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|