Gene name |
SPCC16C4.17 |
Gene ID |
08/D06 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical serine
rich protein; sequence orphan |
Entry clone |
Cloned |
ORF length (unspliced) |
708 |
ORF length (spliced) |
|
Entry clone length |
708 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
5A:G / 18T:C / 300T:A
/ 445T:C / 599A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC16C4.17.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACGTTTAGCTACTCG |
Rev primer name |
SPCC16C4.17.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCGCTATCGAATTCATCA |
Amino acid length |
235 |
Molecular weight |
25.4 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>cytosol) |
Microscope used for
observation |
Confocal |