Gene name |
SPBC23E6.06c |
Gene ID |
08/C11 |
Gene synonyms/obsolete |
|
Gene product |
3,4-Dihydroxy-2-butanone 4-phosphate synthase
(putative); involved in riboflavin biosynthesis |
Entry clone |
Cloned |
ORF length (unspliced) |
706 |
ORF length (spliced) |
615 |
Entry clone length |
706 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
(-7)C:deletion /
(-2)A:deletion |
Comments |
5' terminus is
frameshifted. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC23E6.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTGCATCAATTGAGGA |
Rev primer name |
SPBC23E6.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACATACGCCCTTTAATGTAG |
Amino acid length |
204 |
Molecular weight |
22.5 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|