| Gene name |
SPBC947.07 |
| Gene ID |
08/C03 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in ribosome
biogenesis and assembly; surf-like |
| Entry clone |
Cloned |
| ORF length (unspliced) |
702 |
| ORF length (spliced) |
|
| Entry clone length |
702 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC947.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAACAACTGAAGGAAA |
| Rev primer name |
SPBC947.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTTCTTGGATGGCTTC |
| Amino acid length |
233 |
| Molecular weight |
27.1 |
| Isoelectric point (calc.) |
10.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
209/208/210/128/215/140 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleolus>>nucleus |
| Microscope used for
observation |
Confocal
|