| Gene name |
SPBC577.14c |
| Gene ID |
07/H08 |
| Gene synonyms/obsolete |
spa1; spa |
| Gene product |
ornithine
decarboxylase antizyme; antizyme with programmed ribosomal
frameshift; involved in polyamine regulation; no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
682 |
| ORF length (spliced) |
681 |
| Entry clone length |
682 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
642T:C |
| Comments |
Antizyme with
programmed ribosomal frameshiftGsplicing pattern seems to be
weird. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC577.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGTTTAGGAATCGAAT |
| Rev primer name |
SPBC577.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAGCTCCATGCCGAAAAGA |
| Amino acid length |
226 |
| Molecular weight |
25.8 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Zeiss |