| Gene name |
SPCC1020.04c |
| Gene ID |
07/D07 |
| Gene synonyms/obsolete |
rpb6; rpo15 |
| Gene product |
DNA-directed RNA
polymerases; involved in transcription from Pol I promoter;
involved in transcription from Pol II promoter; involved in
transcription from Pol III promoter; DNA-directed RNA
polymerase activity; interacts physically with Tfs1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
647 |
| ORF length (spliced) |
429 |
| Entry clone length |
647 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
9C:T /
399T:deletion |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1020.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGACTATGAAGAGGA |
| Rev primer name |
SPCC1020.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATGAGCTCCGCTACACTC |
| Amino acid length |
142 |
| Molecular weight |
15.7 |
| Isoelectric point (calc.) |
4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |