| Gene name |
SPCC757.10 |
| Gene ID |
07/A11 |
| Gene synonyms/obsolete |
vph2 |
| Gene product |
involved in vacuolar
ATPase assembly |
| Entry clone |
Cloned |
| ORF length (unspliced) |
624 |
| ORF length (spliced) |
561 |
| Entry clone length |
624 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC757.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTAAAGGAATTACGATT |
| Rev primer name |
SPCC757.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGGTTCTTTTTTTCCTTC |
| Amino acid length |
186 |
| Molecular weight |
21 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCAFSAILVL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |