| Gene name |
SPAC3F10.12c |
| Gene ID |
06/G04 |
| Gene synonyms/obsolete |
|
| Gene product |
centromere binding
protein; basic helix-loop-helix (bHLH); DNA-binding protein
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
606 |
| ORF length (spliced) |
|
| Entry clone length |
606 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
12T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3F10.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAAGAGATATGTCCAT |
| Rev primer name |
SPAC3F10.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGATTCACTATTCTCTTCT |
| Amino acid length |
201 |
| Molecular weight |
23 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
96/89 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |