| Gene name |
SPAPYUK71.02 |
| Gene ID |
06/D02 |
| Gene synonyms/obsolete |
rpb7;
SPACUNK4.06c |
| Gene product |
DNA-directed RNA
polymerase II (subunit); involved in transcription from Pol II
promoter; DNA-directed RNA polymerase activity (function of
complex); DNA-directed RNA polymerase II, core complex;
interacts physically with Rpb6p; interacts physically with
Rpb5p; interacts physically with Rpb4p; interacts physically
with Seb1p; involved in coupling RNA processing to
transcription (implicated) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
586 |
| ORF length (spliced) |
519 |
| Entry clone length |
586 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPYUK71.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTTTCTTCCTCAAAGA |
| Rev primer name |
SPAPYUK71.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGAACGCCTAGATAATCC |
| Amino acid length |
172 |
| Molecular weight |
19.1 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |