| Gene name |
SPCC1840.01c |
| Gene ID |
06/B04 |
| Gene synonyms/obsolete |
mog1;
SPCC790.04c |
| Gene product |
Ran-GTPase;
GTP-binding protein; possibly facilitates the generation of
Ran-GTP from Ran-GDP in the nucleus; involved in mitosis to
interphase transition (required); required for poly(A)(+) RNA
metabolism; functionally complemented by Sc MOG1; involved in
nuclear protein import; interacts physically with Spi1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
573 |
| ORF length (spliced) |
|
| Entry clone length |
573 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1840.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTACAGCTATTCGGTGG |
| Rev primer name |
SPCC1840.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAAATACTGTTTTATCG |
| Amino acid length |
190 |
| Molecular weight |
20.8 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|