| Gene name |
SPAC3A12.16c |
| Gene ID |
06/A04 |
| Gene synonyms/obsolete |
|
| Gene product |
mitochondrial inner
membrane pre-sequence translocase complex; involved in
mitochondrial translocation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
569 |
| ORF length (spliced) |
495 |
| Entry clone length |
569 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
335A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3A12.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTAGCGCGGATCATAC |
| Rev primer name |
SPAC3A12.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACTGCAGCAGGAGCTGCA |
| Amino acid length |
164 |
| Molecular weight |
16.9 |
| Isoelectric point (calc.) |
9.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
3 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAVFEGLGI |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|