| Gene name |
SPCC1442.13c |
| Gene ID |
05/H11 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
G-patch domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
714 |
| ORF length (spliced) |
624 |
| Entry clone length |
714 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
ORF prediction was
changed. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1442.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAATTATTGTGGAAGA |
| Rev primer name |
SPCC1442.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATATAGTCATCATGATGAGC |
| Amino acid length |
207 |
| Molecular weight |
23.6 |
| Isoelectric point (calc.) |
10.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
97/108 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; nucleus; nuclear
dots; spindle microtubules |
| Comments for localization |
scattered SPB |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |